Review



lifeact mcherry sequence  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc lifeact mcherry sequence
    Lifeact Mcherry Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 79 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lifeact mcherry sequence/product/Addgene inc
    Average 93 stars, based on 79 article reviews
    lifeact mcherry sequence - by Bioz Stars, 2026-06
    93/100 stars

    Images



    Similar Products

    93
    Addgene inc lifeact mcherry sequence
    Lifeact Mcherry Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lifeact mcherry sequence/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    lifeact mcherry sequence - by Bioz Stars, 2026-06
    93/100 stars
      Buy from Supplier

    93
    Addgene inc mcherry lifeact 7 coding sequences
    Mcherry Lifeact 7 Coding Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mcherry lifeact 7 coding sequences/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    mcherry lifeact 7 coding sequences - by Bioz Stars, 2026-06
    93/100 stars
      Buy from Supplier

    93
    Addgene inc n a sgrna sequence tcttgagtttgtaacagctg transfected construct
    N A Sgrna Sequence Tcttgagtttgtaacagctg Transfected Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/n a sgrna sequence tcttgagtttgtaacagctg transfected construct/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    n a sgrna sequence tcttgagtttgtaacagctg transfected construct - by Bioz Stars, 2026-06
    93/100 stars
      Buy from Supplier

    94
    Addgene inc sequence verified pinducer20 satb2
    Zebrafish MCR:EGFP (unpigmented) and MCR:SATB2 (pigmented) melanoma phenotype.
    Sequence Verified Pinducer20 Satb2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequence verified pinducer20 satb2/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    sequence verified pinducer20 satb2 - by Bioz Stars, 2026-06
    94/100 stars
      Buy from Supplier

    93
    Addgene inc lifeact sequence
    Epithelial cells exposed to deep hypoxia undertake directional migration towards oxygen. a Schematic diagram of the cell confinement assay. b Z -axis confocal analysis of <t>LifeAct-mCherry-expressing</t> MCF10A cells under confinement (+C) or not (NC), showing a layer of ∼7–10 µm of culture medium supplemented with Oregon Green (green) which separates the cells (red) from the coverslip (black). Right panels are magnified regions from left panels. Scale bars, 100 µm (left), 10 µm (right). c Detection of hypoxia under confinement with the Visisens camera demonstrating the formation of a steep oxygen gradient at the edge of the cell cluster. Oxygen level is shown in pseudocolors (also see Supplementary Movie ). d Immunoblot showing HIF1A stabilisation after confinement (24 h). Molecular weights (Mw) are indicated in kDa. e Hypoxia gradient at the edge of the cluster revealed by HIF1A stabilisation as soon as 1 h after confinement. HIF1A levels are represented in pseudocolors. Scale bar, 200 µm. f Representative sequential images of H2B-GFP-expressing MCF10A cells confined (+C) or not confined (NC) showing outwards migration of the cells from the edge of the cluster. Scale bars, 1 mm. g Individual tracking of cells ( n = 24) at the margin of the cell cluster for 48 h, from experiments depicted in ( f ). Tracking is representative of more than three different experiments (also see Supplementary Movies – ). h Directed migration and redistribution of H2B-GFP-expressing MCF10A cells visualised after 48 h of confinement or unconfined. Left panels: bright field images at 48 h with a red dotted-line indicating the front of the cell cluster at 0 h. Middle panels: tracks of H2B-GFP expressing MCF10A confined or unconfined for 48 h. Right panels: relative distribution of MCF10A cells at the edge of the cluster at 0, 24 and 48 h. Scale bar, 500 µm. i Mean values of directionality and speed calculated from ( g ) (mean ± SD; n = 3 independent experiments). See Methods for further information about the calculation of motility parameters. *** P < 0.001, * P < 0.05 by two-tailed Student’s t -test. NC not confined, +C confined
    Lifeact Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lifeact sequence/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    lifeact sequence - by Bioz Stars, 2026-06
    93/100 stars
      Buy from Supplier

    Image Search Results


    Zebrafish MCR:EGFP (unpigmented) and MCR:SATB2 (pigmented) melanoma phenotype.

    Journal: eLife

    Article Title: SATB2 induction of a neural crest mesenchyme-like program drives melanoma invasion and drug resistance

    doi: 10.7554/eLife.64370

    Figure Lengend Snippet: Zebrafish MCR:EGFP (unpigmented) and MCR:SATB2 (pigmented) melanoma phenotype.

    Article Snippet: Lentiviral particles were produced by co-transfection of 293 T cells with sequence verified pINDUCER20-SATB2, pLentiCMV_SATB2_Blast, or pTK93_Lifeact (Addgene plasmid #46357 was a gift from Iain Cheeseman), and packaging plasmids pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260, both gifts from Didier Trono), using FuGENE HD (Promega).

    Techniques:

    Time-lapse video recording of Oregon Green 488-labeled gelatin degradation upon SATB2 induction in human melanoma cell line A375.

    Journal: eLife

    Article Title: SATB2 induction of a neural crest mesenchyme-like program drives melanoma invasion and drug resistance

    doi: 10.7554/eLife.64370

    Figure Lengend Snippet: Time-lapse video recording of Oregon Green 488-labeled gelatin degradation upon SATB2 induction in human melanoma cell line A375.

    Article Snippet: Lentiviral particles were produced by co-transfection of 293 T cells with sequence verified pINDUCER20-SATB2, pLentiCMV_SATB2_Blast, or pTK93_Lifeact (Addgene plasmid #46357 was a gift from Iain Cheeseman), and packaging plasmids pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260, both gifts from Didier Trono), using FuGENE HD (Promega).

    Techniques:

    MCR:SATB2 primary tumor transplant into transparent Casper zebrafish, 3.5 weeks post-transplant.

    Journal: eLife

    Article Title: SATB2 induction of a neural crest mesenchyme-like program drives melanoma invasion and drug resistance

    doi: 10.7554/eLife.64370

    Figure Lengend Snippet: MCR:SATB2 primary tumor transplant into transparent Casper zebrafish, 3.5 weeks post-transplant.

    Article Snippet: Lentiviral particles were produced by co-transfection of 293 T cells with sequence verified pINDUCER20-SATB2, pLentiCMV_SATB2_Blast, or pTK93_Lifeact (Addgene plasmid #46357 was a gift from Iain Cheeseman), and packaging plasmids pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260, both gifts from Didier Trono), using FuGENE HD (Promega).

    Techniques:

    Epithelial cells exposed to deep hypoxia undertake directional migration towards oxygen. a Schematic diagram of the cell confinement assay. b Z -axis confocal analysis of LifeAct-mCherry-expressing MCF10A cells under confinement (+C) or not (NC), showing a layer of ∼7–10 µm of culture medium supplemented with Oregon Green (green) which separates the cells (red) from the coverslip (black). Right panels are magnified regions from left panels. Scale bars, 100 µm (left), 10 µm (right). c Detection of hypoxia under confinement with the Visisens camera demonstrating the formation of a steep oxygen gradient at the edge of the cell cluster. Oxygen level is shown in pseudocolors (also see Supplementary Movie ). d Immunoblot showing HIF1A stabilisation after confinement (24 h). Molecular weights (Mw) are indicated in kDa. e Hypoxia gradient at the edge of the cluster revealed by HIF1A stabilisation as soon as 1 h after confinement. HIF1A levels are represented in pseudocolors. Scale bar, 200 µm. f Representative sequential images of H2B-GFP-expressing MCF10A cells confined (+C) or not confined (NC) showing outwards migration of the cells from the edge of the cluster. Scale bars, 1 mm. g Individual tracking of cells ( n = 24) at the margin of the cell cluster for 48 h, from experiments depicted in ( f ). Tracking is representative of more than three different experiments (also see Supplementary Movies – ). h Directed migration and redistribution of H2B-GFP-expressing MCF10A cells visualised after 48 h of confinement or unconfined. Left panels: bright field images at 48 h with a red dotted-line indicating the front of the cell cluster at 0 h. Middle panels: tracks of H2B-GFP expressing MCF10A confined or unconfined for 48 h. Right panels: relative distribution of MCF10A cells at the edge of the cluster at 0, 24 and 48 h. Scale bar, 500 µm. i Mean values of directionality and speed calculated from ( g ) (mean ± SD; n = 3 independent experiments). See Methods for further information about the calculation of motility parameters. *** P < 0.001, * P < 0.05 by two-tailed Student’s t -test. NC not confined, +C confined

    Journal: Nature Communications

    Article Title: Redox regulation of EGFR steers migration of hypoxic mammary cells towards oxygen

    doi: 10.1038/s41467-018-06988-3

    Figure Lengend Snippet: Epithelial cells exposed to deep hypoxia undertake directional migration towards oxygen. a Schematic diagram of the cell confinement assay. b Z -axis confocal analysis of LifeAct-mCherry-expressing MCF10A cells under confinement (+C) or not (NC), showing a layer of ∼7–10 µm of culture medium supplemented with Oregon Green (green) which separates the cells (red) from the coverslip (black). Right panels are magnified regions from left panels. Scale bars, 100 µm (left), 10 µm (right). c Detection of hypoxia under confinement with the Visisens camera demonstrating the formation of a steep oxygen gradient at the edge of the cell cluster. Oxygen level is shown in pseudocolors (also see Supplementary Movie ). d Immunoblot showing HIF1A stabilisation after confinement (24 h). Molecular weights (Mw) are indicated in kDa. e Hypoxia gradient at the edge of the cluster revealed by HIF1A stabilisation as soon as 1 h after confinement. HIF1A levels are represented in pseudocolors. Scale bar, 200 µm. f Representative sequential images of H2B-GFP-expressing MCF10A cells confined (+C) or not confined (NC) showing outwards migration of the cells from the edge of the cluster. Scale bars, 1 mm. g Individual tracking of cells ( n = 24) at the margin of the cell cluster for 48 h, from experiments depicted in ( f ). Tracking is representative of more than three different experiments (also see Supplementary Movies – ). h Directed migration and redistribution of H2B-GFP-expressing MCF10A cells visualised after 48 h of confinement or unconfined. Left panels: bright field images at 48 h with a red dotted-line indicating the front of the cell cluster at 0 h. Middle panels: tracks of H2B-GFP expressing MCF10A confined or unconfined for 48 h. Right panels: relative distribution of MCF10A cells at the edge of the cluster at 0, 24 and 48 h. Scale bar, 500 µm. i Mean values of directionality and speed calculated from ( g ) (mean ± SD; n = 3 independent experiments). See Methods for further information about the calculation of motility parameters. *** P < 0.001, * P < 0.05 by two-tailed Student’s t -test. NC not confined, +C confined

    Article Snippet: The lentivector expressing Lifeact-mCherry was constructed by cloning the Lifeact sequence from Addgene plasmid # 54491 into the CSII-EF-mCherry vector.

    Techniques: Migration, Expressing, Western Blot, Two Tailed Test